IEC - Perguntas e respostas recentes em LabTips

Respondida: Que tipo de placa de ensaio usar em experimentos de luminescência, fluorescência ou multiplex?

Wed, 08 May 2024 11:33:31 +0000

Síntese de conclusões reproduzidas de matéria "How to choose the best microplate colour for my assay", da BMG LabTech:

For absorbance assays you will need wells with clear bottoms
For absorbance-based measurements below 320 nm, you must use UV-transparent plates (e.g., cycloolefin microplates)
Black plates are recommended for fluorescence measurements. They significantly reduce commonly encountered autofluorescence and high background signals
For luminescence assays, white plates are recommended to amplify the signal since luminescence assays typically generate weak signals and have low background.
Grey plates additionally reduce cross-talk. For particularly bright luminescence assays, a black plate is also recommended.

Respondida: Que tipo de microplaca devo usar para meu experimento?

Tue, 01 Aug 2023 19:34:26 +0000

Veja as informações disponíveis na matéria indicada abaixo:

BMG LABTECH. "The microplate utility in practice". Disponível em: https://www.bmglabtech.com/en/the-microplate-utility-in-practice/ (Acesso em 01/Ago/2023)'. | Arquivo PDF (VC LabDocs)

Diferentes aspectos físicos das microplacas para experimentos estão representadas em imagens neste link, retiradas dessa matéria.

Respondida: Quais as características do Vetor Amaxa pmaxGFP?

Wed, 31 May 2023 11:58:57 +0000

O vetor Amaxa pmaxGFP (3486pb) acompanha os kits Amaxa Cell Line Nucleofector®, indicado como é um controle positivo de transfecção. Codifica uma proteína repórter GFP de alta fluorescência, obtida do genoma do copépode Pontellina p. Esse vetor não deve ser confundico com o pmaxFPTM-Green-N (4,7kb).

Segue o mapa do vetor pmaxGFP (3486pb):

Para validação por sequenciamento devem funcionar os iniciadores universais abaixo:

CMV Forward: CGCAAATGGGCGGTAGGCGTG
SV40pA-R: GAAATTTGTGATGCTATTGC

No artigo a seguir há informações adicionais sobre a GFP de copépodes Pontellina:

Hunt ME, Scherrer MP, Ferrari FD, Matz MV. Very bright green fluorescent proteins from the Pontellid copepod Pontella mimocerami. PLoS One. 2010 Jul 14;5(7):e11517. doi: 10.1371/journal.pone.0011517. PMID: 20644720.

Respondida: Onde encontro sequências de primers habitualmente usados em sequenciamento de vetores?

Thu, 04 May 2023 13:40:17 +0000

Vide planilha em https://virican.net/lnk/seqprimers (acesso aos membros do ViriCan)

Alternativamente, consulte listagem da AddGene em https://www.addgene.org/mol-bio-reference/sequencing-primers/.

Respondida: Que controles usar para avaliação de apoptose em experimentos baseados em cultura celular?

Mon, 03 Jan 2022 18:48:33 +0000

O artigo abaixo indica rapatinal (Merck Cat# SML1745-5MG - Raptinal 5 MG) como um rápido indutor de apoptose pela via intrínseca:

Palchaudhuri R, Lambrecht MJ, Botham RC, Partlow KC, van Ham TJ, Putt KS, Nguyen LT, Kim S-H, Peterson RT, Fan TM, Hergenrother PJ. A Small Molecule that Induces Intrinsic Pathway Apoptosis with Unparalleled Speed. Cell Reports. 2015; 13:2027–36. DOI:10/f8g9c7

Como efetuar quantificação relativa empregando o método DDCt?

Thu, 04 Jul 2019 11:36:49 +0000

Respondida: Como definir o espaçador a adicionar na porção 5' de iniciadores com incorporação de sítios de restrição para clonagem?

Thu, 29 Nov 2018 18:35:19 +0000

Eis também um artigo útil do BiteSizeBio (original neste link):

Overhang PCR
By Ania Wronski
Have you ever “accidently” forgotten to add the Kozack consensus sequence to the start of a coding genes? Or forgotten to include the stop codon? Did you clone something, then realize you wanted to tag it with something? Or you just want to add restriction enzymes to your PCR product to make it easier to clone into a plasmid? Overhang PCR may be your answer!
What is it?
Overhang PCR is a technique that utilizes the intrinsic fidelity of the 3’ end of primers for a specific sequence to enable you to add on more sequence to the 5’ end (see Figure 1). This allows you to use PCR to amplify a sequence whilst adding nucleotides to either the 5’ or 3’ ends of the sequence. This can then be cloned into a vector backbone for further use.
How does it work?
Primers can be designed that have additional “overhang” sequence at the 3’ ends that will then be incorporated into the PCR product. The first cycle of the PCR program causes the primers to anneal to the template at the complementary sites on the primers and create a product that contains the desired overhang regions. Subsequent cycles then amplify this strand of DNA to give a pool of PCR product that contains the new DNA sequence (See Figure 1).
How to do it?
1. Primer design
Ideally, at least half of your primer should encompass your existing sequence (although I have gone down to as little as a third and had success), to ensure that the 3’ end of the primer can bind to your target sequence. The rest of your primer can be your overhang. You want to aim for primers about 25 basepairs in length, but it depends on how big your desired overhang is (my largest primers were over 100 basepairs).
Note: If you are adding restriction enzymes to the ends of your PCR product, you may need to add some additional sequence in order to digest efficiently.
Figure 1: Basics of how overhang PCR works
In terms of thermodynamic properties, you only need to calculate and ensure you have satisfactory melting temperatures for the portion of the primer that anneals to your template. The manufacturers instructions for your polymerase should tell you what the optimal melting temperatures for primers should be. Do not include the overhang in your Tm calculations as the first and second cycles are the most important and subsequent cycles will amplify the entire transcript.
2. Setup and PCR conditions
Follow the manufacturer’s instructions for your favourite proof-reading enzyme to set up your reaction. I find adding DMSO greatly improves the ability of a PCR reaction to succeed, especially when using potential supercoiled templates such as plasmids or genomic DNA. For the PCR conditions, program the thermocycler as suggested, calculating the annealing temperature from the portion of the primer that anneals to the template, not the entire primer. Visualize the reaction on an appropriate percentage agarose gel, if successful continue to step 3.
As with most procedures in the lab, the PCR reaction may not be successful with your initial settings and you may need to optimize the reaction conditions. I suggest running multiple PCR reactions with annealing temperatures both above and below your initial temperature. If you still are unable to obtain a PCR product, changing polymerases may help, as each polymerase has different buffer compositions and kinetics meaning another polymerase may be more amenable to your PCR reaction. However, it is impossible to predict which ones will work, so I tend to keep the trial polymerase mixes that suppliers send for this purpose.
3. PCR product
Once you have successfully amplified your PCR product, excise the correct band from the agarose gel and gel purify it using your labs methodology or columns. This PCR product can now be used to ligate into a vector, whether it be digested with restriction enzymes that have been engineered into the overhang or poly-A tailed and T/A cloned. Once you have successfully cloned your PCR product into your plasmid of choice, I strongly recommend that you sequence your plasmid to ensure the overhangs are correct and present!
Happy Cloning!

Respondida: Que iniciadores de qPCR utilizar para quantificação de partículas lentivirais?

Thu, 25 Oct 2018 20:49:32 +0000

Vide listagem em https://signagen.com/blog/2015/10/09/lentivirus-titration-using-rt-qpcr/.

No LabDocs, versão em PDF gerada em 20181025.

Respondida: Devo usar transferência úmida ou semi-seca para as membranas de experimento de westerns blot?

Thu, 25 Oct 2018 14:10:02 +0000

Informações úteis em página da Cell Signaling Tech

Are you ready to transfer your protein? Wet vs. semi-dry transfer
Posted by Neha G on Apr 18, 2018 3:15:00 AM
You are all amped up to run a western blot to identify “your favorite protein.” The lysates have been run and proteins separated by SDS-PAGE. Now it’s time to transfer proteins from the gel to the membrane, and you’re sitting wondering….wet or semi-dry?? Or maybe you are better prepared than I was as a graduate student and you already know your next step, in which case you are aware of the pros and cons of wet and semi-dry transfer.
According to conventional lab wisdom, the wet (tank) method provides better transfer from gel to blot, but the semi-dry technique is faster and consumes far less buffer, not to mention being a tidier procedure for the fastidious among us. Wet transfer is less prone to failure due to drying of the membrane, and is especially recommended for large proteins. In semi-dry transfer, the sandwich is placed directly between the positive and negative electrodes. In wet transfer, the sandwich is placed between positive and negative electrodes and submerged in transfer buffer to which an electrical field is applied.
Semi-dry transfer: paper > gel > membrane > paper (all wetted in transfer buffer)
Wet transfer: sponge > paper > gel > membrane > paper > sponge
Larger proteins transfer more slowly from gel to membrane, so you may consider extending the transfer time depending on the size of your protein of interest. If you do this, we recommend lowering the methanol concentration to 5-10% in transfer buffer.
A large part of the decision between wet versus semi-dry transfer is related to the type of membrane being used. While many consider nitrocellulose and PVDF as largely interchangeable, there are some differences to keep in mind. PVDF binds protein via hydrophobic interactions while nitrocellulose binds through both hydrophobic and electrostatic interactions. Pore size is another important factor affecting transfer conditions, and both types of membranes are available in various pore sizes to accommodate user needs. Some manufacturers recommend their membranes be air-dried and re-wetted in methanol prior to blocking to increase binding of transferred proteins and decrease background. This dehydration step removes water between the denatured protein and the membrane. And when necessary, special and difficult situations may call for membrane fixation with paraformaldehyde (Preterre et al), to improve protein retention.
So, for those who must have the absolute highest level of transfer, wet transfer to nitrocellulose may be your best bet. But for speed and ease of use, semi-dry transfer will often be close enough to the mark for general purposes, albeit after some fine-tuning. For many of us, it may just come down to which apparatus is available in our lab, and optimizing transfer conditions for the primary protein of interest.
Well, hopefully your protein didn't run off the gel while you were deep in thought, weighing whether to go with wet vs. semi-dry transfer!

Como fazer conversões de unidades?

Sat, 18 Feb 2017 14:04:31 +0000